Convert one or several FASTQ files (optionally gzip-compressed) to FASTA
format. For each input file, the @ sign starting a FASTQ sequence
header is replaced by the > sign required by the FASTA format, and the
quality lines are dropped. Output files keep the input base name with the
extension changed to .fasta.
Inspired by https://github.com/ambuvjyn/baseq.
Usage
fastq_to_fasta(fastq_files, output_folder = tempdir(), force = FALSE)Arguments
- fastq_files
(character, required) One or more paths to FASTQ files. The
.fastq,.fq,.fastq.gzand.fq.gzextensions are recognized (case-insensitive).- output_folder
(character, default:
tempdir()) Folder where the FASTA files are written. Created if it does not exist.- force
(logical, default: FALSE) If FALSE, existing output files are not overwritten and an error is thrown instead.
Value
A character vector of the paths to the output FASTA files (invisibly named by the input files).
Examples
# \donttest{
fq <- system.file("extdata", "ex.fastq", package = "MiscMetabar")
out <- fastq_to_fasta(fq, output_folder = tempdir())
#> ✔ Wrote 1 FASTA file to /tmp/RtmpMeUGPY.
readLines(out, n = 2)
#> [1] ">M03493:483:000000000-KW735:1:1101:10710:1281 1:N:0:17"
#> [2] "CTTGTTGGAGGGCAAGTCTGGTGCCCGCAGCCGCGGTAATTCCAGCTCCAATAGCGNNTNNTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAATTTCGGGATNNATGGGTTGGTCACGCCCTCGGTATGTACTGATTGCATTGGTGCTCACCTTCTAAGGAACCATGATGTCATTCGTTTGATGTGGTTGGGAATGAGGACTGTTATCTTGAAAAAATTGGAGGGTTTAAAGCAGTCTAACGCTTTAATACATTATCATGGAATAATGAAATCGGACAGCCGATTATATTTTGTTGGCG"
# }